Home Print this page Email this page
Users Online: 337
Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2016  |  Volume : 5  |  Issue : 3  |  Page : 164-168

Detection of human papillomavirus de-oxy-ribose nucleic acid and its genotypes in cervical cancer patients: A step toward vaccine production


1 Department of Radio-oncology, Sri Aurobindo Medical College and PG Institute, Indore, Madhya Pradesh, India
2 Department of Microbiology, Sri Aurobindo Medical College and PG Institute, Indore, Madhya Pradesh, India
3 White Crescent Diagnostic Center, Indore, Madhya Pradesh, India

Date of Web Publication5-Aug-2016

Correspondence Address:
Trupti Bajpai
Assistant Professor, Department of Microbiology, Sri Aurobindo Medical College and PG Institute, MR 10 Crossing, Indore - Ujjain Road, Indore, Madhya Pradesh
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/2278-344X.187809

Rights and Permissions
  Abstract 

Background: India has a highest global burden of cervical cancer. Infection with a high-risk human papillomavirus (HPV) genotype has been identified as the most important etiologic risk factor for the development of cervical cancer. Aim: The aim of the study was to detect the genotype of high-risk HPV-de-oxy-ribose nucleic acid (DNA) in a patient suspected of cervical cancer and to study the epidemiological factors related to cervical cancer patients. Materials and Methods: The present prospective study was carried out from January 2013 to December 2013 in the molecular medicine laboratory located in our tertiary care super-specialty hospital. Fifty-two female patients who presented in the Gynecology and Oncology Outpatient Department with vaginal bleeding were included in the study. Followed by the detection of HPV genotype using specific markers, restriction fragment length polymorphism was done using different digestion enzymes. Results: Of the 52 cervical samples subjected to polymerase chain reaction for the detection of high-risk HPV-DNA, 44 (84.6%) samples tested positive, and 8 (15.3%) samples lacked the HPV-DNA. The overall distribution of the major HPV types was as follows: HPV16 (50%) was the most prevalent genotype, followed by HPV18 (15.3%). Other genotypes included 1.9% HPV33 and 1.9% HPV62 while infection with the mixed type (HPV16 and HPV18) was seen in 15.3% of patients. Conclusion: As we switch from cytology-based screening to HPV-based screening, genotyping could potentially provide information on individual risk stratification, therapeutic decisions, epidemiological studies, and vaccine development.

Keywords: Cervical cancer, human papillomavirus, polymerase chain reaction


How to cite this article:
Bhandari V, Gorie N, Bhatambare G, Bajpai T, Khan Z, Bajpai I. Detection of human papillomavirus de-oxy-ribose nucleic acid and its genotypes in cervical cancer patients: A step toward vaccine production. Int J Health Allied Sci 2016;5:164-8

How to cite this URL:
Bhandari V, Gorie N, Bhatambare G, Bajpai T, Khan Z, Bajpai I. Detection of human papillomavirus de-oxy-ribose nucleic acid and its genotypes in cervical cancer patients: A step toward vaccine production. Int J Health Allied Sci [serial online] 2016 [cited 2021 Feb 26];5:164-8. Available from: https://www.ijhas.in/text.asp?2016/5/3/164/187809


  Introduction Top


Human papillomavirus (HPV) is one of the most common causes of sexually transmitted diseases in both men and women worldwide. [1],[2],[3] It is associated with a variety of clinical conditions that range from innocuous lesions to cancer. [3] Clinical and epidemiological studies have clearly established that infection by certain HPV types is causally linked to cervical cancer development. [4]

Cervical cancer is an important public health problem and approximately 80% of the cases are diagnosed in developing countries. [5] It is the third most common cancer among women worldwide (15%) and second most common in developing countries. [2] More than 200 types of HPV have been recognized on the basis of de-oxy-ribose nucleic acid (DNA) sequence data showing genomic differences. Based on their association with cervical cancer and precursor lesions, HPV's can be grouped as high- and low-risk HPV types. Sixteen types that are commonly isolated from malignant lesions are classified as high-risk type. [3],[5]

Various polymerase chain reaction (PCR) based studies are carried out in different countries for elucidating the clinical implications of HPV infection and the role of HPV in pathogenesis of cervical carcinoma. [5] Identification of HPV as the necessary cause of cervical cancer and subsequent development of effective vaccines against the virus has created considerable optimism worldwide and has major implications for both primary and secondary prevention strategies. [6] Despite the high incidence of cervical cancer reported from India, large scale population based studies on the HPV prevalence and genotype distribution are very few from our region. Hereby, we have investigated the genotypic distribution of high-risk HPV types in the cervical samples.


  Materials and Methods Top


The present prospective study was carried out from January 2013 to December 2013 in the molecular medicine laboratory located in our tertiary care super-specialty hospital. The study was approved by the Institutional Ethics and Research Committee. Fifty-two sexually-active female patients (with abnormal Papanicolaou smear according to Bethesda classification [7] and clinically suspected of cancer cervix) who presented with vaginal bleeding in the gynecology and referred to Oncology Outpatient Department were included in the study. The patients who had already undergone hysterectomy or the one who were diagnosed cases of malignancy other than cancer of cervix were excluded from the study. A detailed history of the patient that included age, residence, religion, literacy, socioeconomic (based on modified Prasad's classification) [8] and marital status, age at first intercourse, number of sexual partners, contraceptive use and number of pregnancies was taken. Following clinical examination of a patient, a punch biopsy from the growth was performed. Tissue biopsy/cervical scrapes were collected in an HPV collection tubes containing sample collection buffer. Biopsies were transported on the ice packs into the laboratory. Following DNA extraction, [9],[10] DNA amplification was carried out in a thermocycler (Eppendorf). [11] The specific primers (HPV16: GATATGGCAGACACATAATGAC; HPV18: CTTAAATTTGGTAGCATCATATATTG) were used in the study. The process involved 35 cycles of denaturation, amplification, and extension to yield a final product of 450 base pairs (bp) which was visualized by agarose gel electrophoresis. Molecular weight markers were used to size the specific fragments. Positive and negative controls were included simultaneously. All HPV-DNA negative specimens were retested for verification of the initial result. Followed by the detection of HPV genotype using specific markers, restriction fragment length polymorphism was done using different digestion enzymes A, B, C, D, and E (EcoR1, BamH1, Hinfl, Hpa11, and Pstl). [12] Visualization of the results was done following gel electrophoresis [Figure 1] and [Figure 2].
Figure 1: Human papilloma virus positivity seen at 450 bp in column 2 and positive control in column 4

Click here to view
Figure 2: Restriction analysis of lane 4 from Figure 1 (patient infected with an oncogenic human papilloma virus). Lane A: Digestion A pattern, Lane B: Digestion B pattern, Lane C: Digestion C pattern, Lane D: Digestion D pattern, Lane E: Digestion E pattern, Lane NC: Negative control, Lane M: Molecular marker

Click here to view



  Results Top


A total of 52 histologically confirmed samples (46 squamous cell carcinoma, 02 adenocarcinoma, 02 moderate dysplasia, and 02 were mild dysplasia) from female patients with abnormal  Pap smear More Detailss (48 cases had invasive cancer Class 5, 02 had high-grade squamous intra-epithelial lesions Class 4, and 02 had low grade squamous intraepithelial lesions Class 3) were subjected to PCR for the detection of high-risk HPV-DNA, 44 (84.6%) samples tested positive and 8 (15.3%) samples lacked the HPV-DNA [Table 1]. Among the 52 female patients who were clinically suspected to be suffering from cervical cancer, 44 samples that were detected to carry HPV-DNA belonged to different age groups; 1 (2.2%) patient belonged to the age group 21-30 years, 15 (34%) patients belonged to the age group 31-40 years, 19 (43.1%) belonged to the age group 41-50 years, 4 (9%) belonged to the age group 51-60 years, 3 (6.8%) belonged to the age group 61-70 years while 2 (4.5%) patients belonged to the age group of >71 years. Among these 52 patients, 38 (73%) patients were from rural, and 14 (26.9%) were from urban region. Out of these 38 patients, 31 (81.5%) carried HPV-DNA and 7 (18.4%) patients lacked the DNA. Out of the 14 urban patients, 13 (92.8%) patients had HPV-DNA and 1 (7.1%) patient lacked the same. Though the results were statistically insignificant (P > 0.05). All the 52 (100%) patients were from low socioeconomic group. The results were statistically significant (P < 0.01). Eight (15.3%) out of 52 patients were literate, and 44 (84.6%) were illiterate. Again the results were highly significant (P < 0.01). Out of the eight literate patients, 7 (87.5%) had HPV-DNA and 1 (12.5%) lacked the DNA. Out of 44 illiterate patients, 37 (84.1%) carried HPV-DNA while 7 (15.9%) lacked the same. Furthermore, out of 52 patients, 33 (63.4%) were noncontraceptive users. Among the 19 (36.5%) contraceptive users, 16 (84.2%) had underwent tubal ligation, 1 (5.2%) of them had a male partner who had undergone vasectomy, 1 (5.2%) of them had underwent tubal ligation as well as she declared the use of oral contraceptives while only 1 (5.2%) of them confirmed the use of barrier contraceptives. Out of the 19 contraceptive users, 18 (94.7%) carried HPV-DNA and 1 (5.2%) lacked the DNA. Out of the 33 noncontraceptive users, 27 (81.8%) had the DNA and 6 (18.1%) lacked the same. Fifteen out of 17 patients who had undergone tubal ligation and all the three patients who had followed other methods of contraception were detected to bear HPV-DNA among their samples.
Table 1: Distribution of high risk human papilloma virus genotype


Click here to view



  Discussion Top


The prevalence of HPV-DNA types is known to fluctuate worldwide. Despite the high incidences of cervical cancer reported from India, very few studies have been done in relation to detection of prevalence and related genotypes.

In our study, out the 52 female patients who were clinically suspected to be suffering from cervical cancer, 44 (84.6%) were detected to carry HPV-DNA, which was found to be statistically significant (P < 0.05). A total of 08 (15.3%) samples lacked the HPV-DNA. This may be because there can be other reasons responsible for cervical cancer. Among the 41 high-risk HPV-positive cervical cancers, the overall distribution of the major HPV types was as follows: HPV16 (50%) was the most prevalent genotype, followed by HPV18 (15.3%). Other genotypes included 1.9% HPV33 and 1.9% HPV62 while infection with the mixed type (HPV16 and HPV18) was seen in 15.3% patients. Our results were similar to the study performed by Sowjanya et al. in Hyderabad, where HPV16 (66.7%) was detected as the predominant DNA type followed by HPV18 (19.4%) and HPV33 in 5.6% patients. However, the most frequently detected HPV types were HPV52 and HPV16 in the study performed in Medchal community, Andhra Pradesh. [12] Similarly, another study from South India revealed high-risk HPV16 (47%) dominating over HPV33 (10%). [13] Furthermore, a study from East India revealed 60% HPV16 followed by 14% HPV18 infection as the most frequent types and a study from New Delhi detected HPV16 as the most common (73.6%) type followed by HPV18 (14.2%) and HPV45 in 11.3% patients. [14] Similarly, a study performed in Peru revealed 83.9% HPV16 followed by 15.3% HPV18 and HPV31 in 8.6% patients. Infection of multiple types was seen in 11.1%. [15] A study conducted by Odida et al. in Uganda revealed 61.3% of samples with HPV16 DNA followed by 28.8% HPV18 DNA and HPV31 in 3.5% patients while infection with multiple types was seen in 3.6% of samples. [4] Most of the international studies also revealed the same prevalence as in Indian studies showing the high-risk HPV 16 and 18 types being most commonly associated with cervical cancer. [16],[17] High-risk genotypes like HPV 31, 35, 42, 52, and 56 which are common in other parts of the country were not detected in our study. However, our results were not compared with any histological findings.

Age-specific incidence rates for cervical cancer reveals that the disease increases from age group 35 and reaches a peak between 55 and 64 years. [18] Similarly, WHO/Institut Català d'Oncologia information center on HPV and cervical cancer (HPV information center) in their summary report 2010 have indicated the increasing trend in the age wise incidence of cervical cancer among Indian women from the third decade onward with a peak at 60-65 years of age group. [19] Similar age incidence rate is also seen in our study group where 36 (81.8%) patients carrying HPV-DNA belonged to the age group from 36 to 65 years.

In our study, 73% of cases were from rural areas while 27% were from urban areas. However, more urban patients (92.8%) were confirmed to carry HPV-DNA as compared to rural patients (81.5%). In our country, highest incidence of cancer is found in Barshi (37%) a rural area of Maharashtra state; whereas it is highest (30.7%) in the urban areas of Chennai. Such results can be attributed to the differences in the lifestyle of rural and urban areas. [20] The reason for more rural cases in our study is because ours is a tertiary care center serving majority of population from rural areas. Detection of more cases in urban areas can be explained by the lesser discrepancies in the sample collection methods in the urban as compared to the rural areas. Furthermore, the factors that confound in urban areas may be the presence of affluent society and mixed ethnic population. Population-based survey in Bangladesh revealed that prevalence of any HPV infection was 7.7% with no significant difference between urban and rural population. [21]

In our study, all the cases were from low socioeconomic group which resembled the studies made by Sherwani et al., Franceschi et al. and Pandey and Bhagoliwal thereby confirming the inverse relationship between cervical cancer and socioeconomic status. [20],[22],[23] It has also been stated that improvement in socioeconomic status can reduce cervical cancer morbidity and mortality significantly. In our case, the reason of having higher population of patients from low socioeconomic group can be due to the location of our tertiary care center in rural region, mostly serving rural population. Even the patients from urban population in our study were of low socioeconomic group thereby confirming 100% population belonging to low socioeconomic group. Biswas et al., however, did not find any difference in the income group of cases and controls. [24] Singh found that 9.5% of women of upper socioeconomic status group had ever heard of cervical cancer with only 11.6% underwent at least one cervical cancer screening in their lifetime. [25]

Though more number of cases (84.6%) in our study included illiterate patients but greater number of literate patients (87.5%) carried HPV-DNA as compared to illiterate ones (84.1%) but no significant difference was found in the number of positive cases. Such differences only depend upon the awareness of the society about the cervical cancer.

In our study, 18 (94.7%) out of 19 contraceptive users carried HPV-DNA in their samples as compared to 27 (81.8%) noncontraceptive users. Comparatively more (18.1%) noncontraceptive users were found to lack HPV-DNA than the contraceptive users (5.2%). Tubal ligation (32.6%) was the most used methods of contraception in our study which was similarly mentioned in the reports of Franceschi et al. [23] However, such methods are unrelated to HPV positivity and cervical cancer. According to a retrospective study conducted by Mohanty and Mohanty it was found that in tubal ligation users, the incidence of cervical cancer was 80% whereas in oral contraception users 10% had cervical cancer. No malignancy was detected in barrier contraception and uterine contraceptive user. [26] Hammouda et al. and Cavalcanti et al. found that oral contraception was unrelated to the development of cervical cancer. [27],[28] Actually, use of contraception is not associated with higher rates of cervical cancer. It is not the oral contraception; rather it is the sexual behavior that might increase the risk of development of cervical cancer. Furthermore, barrier contraception like condom can only offer partial protection against sexually transmitted high-risk HPV and subsequent development of cancer. Because it can only protect the covered areas of external genitalia, while uncovered areas remain exposed to risk of HPV viral transmission.

Therefore, in our study, though there were more cases from rural areas with the population of illiterate women; HPV-DNA was detected in larger percentage in literate (87.5%) women of urban (92.8%) population as compared to illiterate (84.1%) of rural areas (81.5%). In addition, more (97.1%) women who followed any of the methods of contraception were found to carry HPV-DNA as compared to women (81.8%) who were noncontraceptive users. Thus, it can be said that residential status, literacy, socioeconomic status, and contraceptive use (including method of contraception) does not necessarily affect the positivity of cervical cancer in women. A few of the factors could not be correlated on account of the availability of incomplete information due to noncooperation of patients.

These findings make us aware of epidemiology of HPV in cervical cancer in our region. In addition, they represent the variation of high-risk HPV according to geographical distribution. Knowledge of local genotypes helps to choose correct combination of HPV genotypes for vaccine production as well as for inclusion in diagnostic kits. The current data on the basis of which the vaccine has been marketed are mostly on the basis of large-scale studies but on the foreign population with a different ethnic and social profile. Our study serves as a baseline before the HPV vaccination is initiated on the large scale. This knowledge is important to monitor trends in distribution of high-risk HPV in the postvaccination era on a broader aspect as well as on an individual case to case basis. Testing of patients before and after treatment of cervical cancer helps to detect the relapse or recurrence at much earlier stage as compared to routine cytology or histology. Several studies of cervical cancers, both cross-sectional and prospective, have shown that specific types predict the risk of progression to the high-grade cervical intraepithelial neoplasia. Therefore, genotyping could potentially provide information on individual risk stratification, therapeutic decisions, epidemiological studies, and vaccine development.


  Conclusion Top


Cervical cancer screening is now entering a new era in which we will increasingly rely on oncogenic HPV detection rather than the pleomorphic cellular changes produced during infection. As we move from cytology-based screening to HPV-based screening, genotyping may prove useful in stratifying HPV positive women according to the risk of precancer and cancer to determine the appropriate clinical management strategy. The study emphasizes the introduction and use of quadruple vaccine based on the generated data.

Acknowledgment

The authors would like to thank the management, technical and clinical staff of Sri Aurobindo Institute of Medical Sciences Medical College and PG Institute for their kind support. The first author is also grateful to Dr. Sushmit for providing necessary help during the endeavor.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
  References Top

1.
Chloe CN, Chu LO, Chow JK, Tam JW, Ng EK. HPV prevalence and detection of rare HPV genotypes in Hong kong women from Southern China with cytological abnormalities. ISRN Virol 2013;2013:1-5.  Back to cited text no. 1
    
2.
Hoste G, Vossaert K, Poppe WA. The clinical role of HPV testing in primary and secondary cervical cancer screening. Obstet Gynecol Int 2014;2013:1-7.  Back to cited text no. 2
    
3.
Burd EM. Human papillomavirus and cervical cancer. Clin Microbiol Rev 2003;16:1-17.  Back to cited text no. 3
    
4.
Odida M, de Sanjosé S, Quint W, Bosch XF, Klaustermeier J, Weiderpass E. Human Papillomavirus type distribution in invasive cervical cancer in Uganda. BMC Infect Dis 2008;8:85.  Back to cited text no. 4
    
5.
Banik U, Ahamad MS, Bhattacharjee P, Adhikary AK, Rahman Z. High risk human papillomavirus type 16 and 18 infection in the cervical lesions of women with epithelial cell abnormality in pap smear: A cytohistomorphologic association in Bangladeshi women. Cytojournal 2013;10:14.  Back to cited text no. 5
[PUBMED]  Medknow Journal  
6.
Basu P, Roychowdhury S, Bafna UD, Chaudhury S, Kothari S, Sekhon R, et al. Human papillomavirus genotype distribution in cervical cancer in India: Results from a multi-center study. Asian Pac J Cancer Prev 2009;10:27-34.  Back to cited text no. 6
    
7.
Gholap BJ. Study of cervical cytology in women of age 35-54. 2009. p. 1-26.  Back to cited text no. 7
    
8.
Eko F. Restriction length polymorphism. In: Pramanik J, Khole V, editors. Bacterial Ghost Based Vaccine Development. Mumbai: NIRRH publication; 2008. p. 43-7.  Back to cited text no. 8
    
9.
Sanjosé S, Diaz M, Castellsagué X, Clifford G, Bruni L, Muñoz N, et al. Worldwide prevalence and genotype distribution of cervical human papillomavirus DNA in women with normal cytology: A meta-analysis. Lancet Infect Dis 2007;7:453-59.  Back to cited text no. 9
    
10.
Hubbard RA. Human papillomavirus testing methods. Arch Pathol Lab Med 2003;127:940-5.  Back to cited text no. 10
    
11.
Kado S, Kawamata Y, Shino Y, Kasai T, Kubota K, Iwasaki H, et al. Detection of human papillomaviruses in cervical neoplasias using multiple sets of generic polymerase chain reaction primers. Gynecol Oncol 2001;81:47-52.  Back to cited text no. 11
    
12.
Sowjanya AP, Jain M, Poli UR, Padma S, Das M, Shah KV, et al. Prevalence and distribution of high-risk human papillomavirus (HPV) types in invasive squamous cell carcinoma of the cervix and in normal women in Andhra Pradesh, India. BMC Infect Dis 2005;5:116.  Back to cited text no. 12
    
13.
Gilham C, Varghese C, Gibson I, Peto J. HPV Infection in a Population Based Study in Kerala, India. 23 rd International Papilloma Virus Conference and Clinical Workshop; 2006.  Back to cited text no. 13
    
14.
Datta P, Patro RK, Bhatla N, Singh N. Prevalence of Human Papillomavirus Infection in a Cohort of Young Women in Delhi, India. Available from: http://www.fasebj.org/cgi/content/meeting_abstract.  Back to cited text no. 14
    
15.
Santos C, Muñoz N, Klug S, Almonte M, Guerrero I, Alvarez M, et al. HPV types and cofactors causing cervical cancer in Peru. Br J Cancer 2001;85:966-71.  Back to cited text no. 15
    
16.
Benjamin GE, Ernesto M, Fernandez EA. Genotypes distribution of human papillomavirus (HPV) in histological section of cervical intra epithelial neoplasia and invasive cervical carcinoma in Madrid, Spain. BMC Cancer 2012;12:533.  Back to cited text no. 16
    
17.
Kaliterna V, Kaliterna M, Pejkovic HI, Andelinovic S. Prevalence and genotyping of the human HPV in the cervical specimen among women of Southern Croatia. Cent Eur J Public Health 2013;21:26-9.  Back to cited text no. 17
    
18.
Murthy NS, Chaudhry K, Saxena S. Trends in cervical cancer incidence - Indian scenario. Eur J Cancer Prev 2005;14:513-8.  Back to cited text no. 18
    
19.
WHO/ICO Information Centre on HPV and Cervical Cancer (HPV Information Centre). Summary Report on HPV and Cervical Cancer Statistics in India; 2007. Available from: http://www.who.int/hpvcentre.  Back to cited text no. 19
    
20.
Pandey K, Bhagoliwal A. Cancer cervix-need for mass surveillance program especially in rural areas. J Obstet Gynecol India 2005;55:436-9.  Back to cited text no. 20
    
21.
Nahar Q, Sultana F, Alam A, Islam JY, Rahman M, Khatun F, et al. Genital human papillomavirus infection among women in Bangladesh: Findings from a population-based survey. PLoS One 2014;9:e107675.  Back to cited text no. 21
    
22.
Sherwani RK, Khan TK, Akhtar K, Zeba A, Siddiqui FA, Rahman K, et al. Comparison of conventional pap and liquid based cytology. J Cytol 2007;24:167-72.  Back to cited text no. 22
  Medknow Journal  
23.
Franceschi S, Rajkumar T, Vaccarella S, Gajalakshmi V, Sharmila A, Snijders PJ, et al. Human papillomavirus and risk factors for cervical cancer in Chennai, India: A case-control study. Int J Cancer 2003;107:127-33.  Back to cited text no. 23
    
24.
Biswas LN, Manna B, Maiti PK, Sengupta S. Sexual risk factors for cervical cancer among rural Indian women: A case-control study. Int J Epidemiol 1997;26:491-5.  Back to cited text no. 24
    
25.
Singh N. HPV and cervical cancer - Prospects for prevention through vaccination. Indian J Med Paediatr Oncol 2005;26:20-3.  Back to cited text no. 25
    
26.
Mohanty J, Mohanty BK. Risk factors for invasive carcinoma of cervix. J Obstet Gynecol India 2001;21:403-6.  Back to cited text no. 26
    
27.
Hammouda D, Muñoz N, Herrero R, Arslan A, Bouhadef A, Oublil M, et al. Cervical carcinoma in Algiers, Algeria: Human papillomavirus and lifestyle risk factors. Int J Cancer 2005;113:483-9.  Back to cited text no. 27
    
28.
Cavalcanti SM, Deus FC, Zardo LG, Frugulhetti IC, Oliveira LH. Human papillomavirus infection and cervical cancer in Brazil: A retrospective study. Mem Inst Oswaldo Cruz 1996;91:433-40.  Back to cited text no. 28
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed685    
    Printed18    
    Emailed0    
    PDF Downloaded114    
    Comments [Add]    

Recommend this journal